Environmental DNA in Southern Sydney Harbour
Share
|
|
As my first journal post, I thought that I would explain a little about a new biological monitoring tool based around DNA sequencing technologies and environmental DNA (or eDNA) that we are using in this project to compliment your in situ underwater observations uploaded here to iNaturalist. eDNA can be thought of as genetic “breadcrumbs” left behind in the environment that can identify every living thing, from microbes to mammals, thus fixing a more holistic lens on ecosystem health and function. Inside the cells of organisms lies a genetic code, and individual plants and animals shed tens of thousands of these cells into our oceans each day as they go about their business.
Capturing these breadcrumbs is as easy as filtering some of the seawater sampled at a coastal or marine site of particular interest, extracting the DNA in the filtrate, sequencing that DNA, and then assigning these DNA barcodes to specific species, akin to a barcode on supermarket items that can identify your snack purchases. These barcodes are small segments of DNA distinguished by the order and composition of A’s, T’s, C’s, and G’s. For example, one of the common fishes observed in Parsley Bay is Luderick (Girella tricuspidata), whose unique DNA barcode at the eDNA assay that we are using is:
CTGGCCTTAAACATTGATGGCACGATACAACCGCCATCCGCCTGGAAACTACGAGCACCAGCTTGAAACCCAAAGGACTTGGCGGTGCTTTAGATCCAC.
This DNA barcode is very different from that of any other fish, including the four, other closely related Australian species in the Girella genus, some of which are similar in appearance.
Here I am sharing a sneak peek at the organisms assigned to our very first eDNA samples collected at two locations in Parsley Bay (Vaucluse) and two locations in Camp Cove (Watsons Bay) processed by our friends at Wilderlab in New Zealand (https://www.wilderlab.co.nz/). You can see on their “Wheels of Life” that because we are using a number of different genetic tests, we can reveal plants and animals across the tree of life each time that we sample seawater at these sites. You can explore each individual sample and the organisms revealed in greater detail here.
https://s3.ap-southeast-2.amazonaws.com/wilderlab.openwaters/reports/5483097b597f16dc.html
https://s3.ap-southeast-2.amazonaws.com/wilderlab.openwaters/reports/5483097b597f16dc.html
https://s3.ap-southeast-2.amazonaws.com/wilderlab.openwaters/reports/8f587f8ffc740071.html
https://s3.ap-southeast-2.amazonaws.com/wilderlab.openwaters/reports/bf2afd0fa9cb8482.html
https://s3.ap-southeast-2.amazonaws.com/wilderlab.openwaters/reports/85a7b9d367cd7dfb.html
The aim is to use your iNaturalist observations to ground truth our eDNA detections. Also, with 12 months of sampling at these two sites, we hope to have a much broader picture of the plants and animals that call these special places in southern Sydney Harbour home.
This journal post was written by project leader and iNaturalist member, Dr Joseph DiBattista.
Originally published on the iNaturalist project journal.